
Posts: 2443
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
R- Z2110 (KV7Y2)
PostPosted: Sat Feb 25, 2017 9:22 am
Hi Mr Hintermann, I'll ask you to take away from our discussion FTDNA, even though they sent me your request through Ysearch, but I'd ask you if you sent it recently to me or some time ago, because it could have something to do with recent contrasts I had with an administrator. I had some problems with that firm, because I am searching for the truth and they have an agenda of theirs that people knows so well.
1) I'll delete my account on Ysearch EH95T I created only for studying your haplotype reconstructing a possible modal (Hintermanti was simply a mix of Hintermann and Bramanti). The only real person linked to you is Bramanti, but unfortunately also Marco Grassi and me weren't able to contact him.
2) You belong to the R-U152-L20-Z291 subclade. You are also in the Rocca's tree:
NA19649 is R-Z291*
NA20515 is the subclade Y:807993 A>G, Y8700476 T>C, CTS4069?
FTDNA 280359, E8588 (you) are the subclade with the deletion in 22562563, which is atually a mutation in a STRs, i.e. DYS578 from 9 to 7. I wrote to you that this mutation is so rare that all the R-U152 with DYS578=7 very likely belong to your cluster, thus we may individuate other samples in the FTDNA U152 Project. These:
6064 Richard Doude, b.c. 1552, Great Chart, Kent England R-L20
13 23 14 10 11-14 12 12 12 13 13 29 17 9-10 11 11 25 15 19 28 15-15-15-17 10 11 19-23 15 15 20 18 37-40 12 12 11 7 15-16 8 10 10 8 10 11 12 23-23 16 10 12 12 14 8 15 23 20 13 12 11 13 12 11 12 11
107466 Alfred Kinsner/Dowd, b. 1892 and d. 1974 United States R-L20
13 23 15 11 11-14 12 12 12 13 13 29 17 9-10 12 11 25 15 19 28 15-15-16-17 10 11 19-23 15 15 19 18 37-40 12 12 11 7 15-16 8 10 10 8 10 10 12 23-23 16 10 12 12 14 8 14 23 20 13 12 11 13 12 11 12 11
28579 Thomas Fox, 1608, near Norwich, Norfolk, England England R-L20
13 24 14 11 11-14 12 12 13 13 13 30 17 9-10 11 11 25 15 19 29 15-16-17-17 10 11 19-23 15 15 18 18 37-38 12 12 11 7 15-16 8 10 10 8 10 10 12 23-24 16 10 12 12 15 8 13 23 20 13 12 11 13 11 11 12 12 35 15 9 16 12 26 26 19 12 11 13 12 10 9 12 12 10 11 11 29 12 14 24 13 10 10 20 15 18 15 24 16 12 15 24 12 24 19 10 14 17 9 12 11
N115145 Michel LeTonnelier, b. 1470 and d. 1565 Germany R-L20
13 24 14 11 11-14 12 12 13 13 13 29 16 9-10 11 11 25 14 20 29 14-15-16-17 9 10 19-23 15 15 18 18 35-38 12 12 11 7 15-16 8 10 10 8 10 10 12 23-23 16 10 12 12 15 9 13 22 20 13 12 11 13 11 11 12 12 35 15 9 16 12 25 26 19 12 11 12 12 10 9 12 11 10 11 11 30 12 14 24 13 10 11 20 15 19 15 25 17 12 16 24 12 23 18 10 14 17 9 13 11
U152> L2> Z258,Z367,Z384> L20 et al.> Z291> BY3556 et al. 280359 Jose Antonio Castro, b. ca. 1807 Puerto Rico R-BY3556
13 24 14 10 11-14 12 12 12 13 13 29 18 9-9 11 11 26 14 19 29 14-15-17-18 11 10 19-23 15 15 16 19 36-38 12 12 11 7 15-16 8 10 10 8 11 10 12 23-23 16 10 12 12 15 8 12 22 21 13 12 11 13 10 11 12 12
N78666 George White, C1735 - d 27 Feb 1803, Wolveston, Bi England R-BY3556
13 24 14 10 11-15 12 12 13 14 13 30 18 9-10 11 11 24 15 19 30 15-15-16-17 11 11 19-23 16 14 17 18 35-37 12 12 12 7 15-16 8 10 10 8 10 10 12 23-23 16 10 12 12 13 8 13 23 20 13 12 11 13 11 11 12 12 34 15 9 16 12 26 26 19 12 11 13 12 10 9 12 12 10 11 11 30 12 13 24 13 10 10 22 15 18 14 24 16 12 15 24 13 24 18 10 14 16 9 12 11
U152> L2> Z258,Z367,Z384> L20 et al.> Z291> BY3556 et al.> rs759841057> CTS4069,L737 et al. E8588 Konrad Hintermann, b.c. 1435, Weiningen ZH, Switze Switzerland R-CTS4069
13 24 14 11 11-15 12 12 12 13 13 29 16 10-10 11 11 25 16 19 30 15-15-16-17 10 8 19-23 15 15 18 18 35-35 12 12 11 7 15-16 8 10 10 8 10 10 12 23-23 16 10 12 12 15 8 12 23 20 13 12 11 13 11 11 12 12 36 14 9 16 12 26 26 20 13 11 13 12 10 9 12 12 10 11 11 31 12 13 24 13 10 10 20 15 20 15 24 17 14 15 25 12 23 18 10 14 15 9 12 11
Thus we know that there is a Southern American of probable Iberian origin who gets the oldest haplotype (NA19649), that there is a Swiss like you with DYS578=7 but with H4=11 before the multistep mutation to 8 you share with Bramanti, and there is a Tuscan (NA20515) which hasn't the mutation in DYS578 from 9 to 7.
3) What may we think about the origin of R-U152-L20-Z291? All the hypotheses remain open (Iberian diffusion with BB, Italian diffusion, diffusion from Central Europe, links with Celts or German peoples, etc etc). Only other data or the aDNA could resolve the question.
YFull assigns so far to Z291 an age of 4000 years:
R-L20 L20/S144 * Z1908/CTS1939 * Z2533/Z1921/PF129 3600 ybp, TMRCA CI 95% 4400 3500 ybp" class="age"formed 4100 ybp, TMRCA 4000 ybp
R-Z291 Z291/S256 * S20650
⦁ id:NA20515 TSI
⦁ id:NA19649 MXL

Posts: 2443
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
R- Z2110 (KV7Y2)
PostPosted: Sat Feb 25, 2017 9:40 am
Of course that Tuscan NA20515 hasn't the mutation in DYS578 from 9 to 7 is only a mistake of the tree of Rocca, because from YFull results that he has that:
Sample ID HG 22562559 22562560 22562561 22562562 22562563 22562564 22562565 22562566 22562567
NA19649 R-Z291 A T C T C A A A T
NA20515 R-Z291 A T C T C X X X X
Sample ID HG 22562568 22562569 22562570 22562571 22562572 22562573 22562574 22562575 22562576
NA19649 R-Z291 A A A T A A A T A
NA20515 R-Z291 X X X X A A A T A
Sample: #YF02873 (R-Z2110) ChrY position: 22562563 (+strand) Reads: 3 Position data: 3C Weight for C: 1.0 Probability of error: 0.0 (0<->1) Sample allele: C Reference (hg19) allele: C Reference sequence (100bp): GAGATCACGCCACTCCACTCTAGCCTGGATGACACAACAAAACTCCATCT
It is just DYS578.

Posts: 2443
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
R- Z2110 (KV7Y2)
PostPosted: Sat Feb 25, 2017 9:59 am
"Also for other L20 branch the age is 4000 years..
as CTS9733
the hyp. age of indoeuropean and bronze age expansion..
and after the roman - celtic expansion.
i don't see problems for this age".

I doubt very much that the Mexican sample (NA19649) with DYS578=9 and the Tuscan sample (NA20515) with DYS578=7 separated at the beginning of the subclade. Very likely the YFull dates should be multiplied for an 1.17 factor if Poznik is right about the separation of A00 from A0-T at 275000 years or at least for an 1.26 factor if Shi Huang and his colleagues are right with their more than 300000 years.
Also FTDNA 167970 and FTDNA 267955 are Z291 but with DYS578=9.

Posts: 2443
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
R- Z2110 (KV7Y2)
PostPosted: Sat Feb 25, 2017 11:18 am
Gioiello said...
But haven't you realized yet that all these data demonstrate that R1b expanded from West and that my theory of an Italian Refugium, not only about the oldest subclades, is demonstrated? Read my posts about R-U152-L20-Z291 and you'll understand that meanwhile I went long far from your questions...
February 25, 2017 at 3:14 AM

Posts: 2443
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
R- Z2110 (KV7Y2)
PostPosted: Sat Feb 25, 2017 12:15 pm
February 25, 2017 at 3:14 AM
Davidski said...
But what if R1b-L51 is from Western North Pontic Steppe Mesolithic foragers? And what if it arrived in Italy only during the Bronze Age?

The data in the new paper will probably be able to demonstrate this if that's what happened.
February 25, 2017 at 3:29 AM
Gioiello said...
@ Davidski

Look at my avatar, the map of R-L51-PF7589 that Argiedude and me did many years ago: Eastward Italy R-L51 (in its survived subclade PF7589) is 0,00%. Italy has the highest frequency and variance...
Davidski said...
But that's irrelevant if West North Pontic Steppe foragers have a lot of L51, and it doesn't show up in the ancient DNA record in Italy until the Bronze Age, along with steppe admixture.
February 25, 2017 at 3:46 AM
Gioiello said...
I have Always considered that R1b (and much other) from the Italian Refugium after the Younger Dryas expanded and Balkans may have been one of the places, but also all the other subclades are more in Western Europe than the Balkans, and you should know what I think about the R-L23 found at Samara and eastern Europe. Anyway we all are waiting for the aDNA, but it seems to me a complete defeat of all the PhDs of Harvard, Stanford and all their sponsors, and also the false agenda they had. I regret only for my dear friend Sam Vass, an Ashkenazic Jew belonging to R-V88 perhaps I caused some grief with my theory. "A grief ago" the poet said...
February 25, 2017 at 3:53 AM

Posts: 2278
Joined: Fri Mar 16, 2012 5:43 pm

PostPosted: Sun Feb 26, 2017 11:53 am
Gioiello wrote:February 25, 2017 at 3:14 AM
Davidski said...
But what if R1b-L51 is from Western North Pontic Steppe Mesolithic foragers? And what if it arrived in Italy only during the Bronze Age?

The data in the new paper will probably be able to demonstrate this if that's what happened.
February 25, 2017 at 3:29 AM
Gioiello said...
@ Davidski

Look at my avatar, the map of R-L51-PF7589 that Argiedude and me did many years ago: Eastward Italy R-L51 (in its survived subclade PF7589) is 0,00%. Italy has the highest frequency and variance...
Davidski said...
But that's irrelevant if West North Pontic Steppe foragers have a lot of L51, and it doesn't show up in the ancient DNA record in Italy until the Bronze Age, along with steppe admixture.
February 25, 2017 at 3:46 AM
Gioiello said...
I have Always considered that R1b (and much other) from the Italian Refugium after the Younger Dryas expanded and Balkans may have been one of the places, but also all the other subclades are more in Western Europe than the Balkans, and you should know what I think about the R-L23 found at Samara and eastern Europe. Anyway we all are waiting for the aDNA, but it seems to me a complete defeat of all the PhDs of Harvard, Stanford and all their sponsors, and also the false agenda they had. I regret only for my dear friend Sam Vass, an Ashkenazic Jew belonging to R-V88 perhaps I caused some grief with my theory. "A grief ago" the poet said...
February 25, 2017 at 3:53 AM

An Italian and Neolithic origin for L51 looks right and all credit to Gioiello who discovered this years ago from his study of YSTR patterns within haplotypes.

Could the naysayers show us the modern surviving Basal branches of L51 around the Sok river and the Samara region today? If L51 was so prolific in west Europe then they should be equally as prolific in East Europe. There has always been those who like to travel and those who who like to stay close to the home. The new theory is that all R1b L51 died out except of course for the Z2106. They survived the epidemics. :)



Posts: 2278
Joined: Fri Mar 16, 2012 5:43 pm

PostPosted: Wed Mar 01, 2017 8:22 am
dartraighe wrote:
Gioiello wrote:February 25, 2017 at 3:14 AM
Davidski said...
But what if R1b-L51 is from Western North Pontic Steppe Mesolithic foragers? And what if it arrived in Italy only during the Bronze Age?

The data in the new paper will probably be able to demonstrate this if that's what happened.
February 25, 2017 at 3:29 AM
Gioiello said...
@ Davidski

Look at my avatar, the map of R-L51-PF7589 that Argiedude and me did many years ago: Eastward Italy R-L51 (in its survived subclade PF7589) is 0,00%. Italy has the highest frequency and variance...
Davidski said...
But that's irrelevant if West North Pontic Steppe foragers have a lot of L51, and it doesn't show up in the ancient DNA record in Italy until the Bronze Age, along with steppe admixture.
February 25, 2017 at 3:46 AM
Gioiello said...
I have Always considered that R1b (and much other) from the Italian Refugium after the Younger Dryas expanded and Balkans may have been one of the places, but also all the other subclades are more in Western Europe than the Balkans, and you should know what I think about the R-L23 found at Samara and eastern Europe. Anyway we all are waiting for the aDNA, but it seems to me a complete defeat of all the PhDs of Harvard, Stanford and all their sponsors, and also the false agenda they had. I regret only for my dear friend Sam Vass, an Ashkenazic Jew belonging to R-V88 perhaps I caused some grief with my theory. "A grief ago" the poet said...
February 25, 2017 at 3:53 AM

An Italian and Neolithic origin for L51 looks right and all credit to Gioiello who discovered this years ago from his study of YSTR patterns within haplotypes.

Could the naysayers show us the modern surviving Basal branches of L51 around the Sok river and the Samara region today? If L51 was so prolific in west Europe then they should be equally as prolific in East Europe. There has always been those who like to travel and those who who like to stay close to the home. The new theory is that all R1b L51 died out except of course for the Z2106. They survived the epidemics. :)



It does not matter if western Europeans have 90% "Yamnaya" autosomal dna the facts are that U106 and P312 are western European Neolithic origin branches of L51. The "Yamnaya invasion" was a BA invasion according to the experts. That is a reality that some do not want to accept.

Return to R1b-U152/S28

Who is online

Users browsing this forum: No registered users and 1 guest